bbegoviennshearlg bbegoviennshearlg

04-03-2016
History

contestada

Regional conflicts from the 1945-present have been a result of:
A. Religious differences
B. Cultural differences
C. Ethnicity
D. All of the above

Respuesta :

HistoryGuy HistoryGuy

11-03-2016

Generally speaking, regional conflicts from the 1945-present have been a result of "D. All of the above," since this is the "post-war" era, and many European countries were left with a power vacuum after World War II.

Answer Link

Otras preguntas

To rename a worksheet, you change the text on the ? HELP ASAP A. Sheet Columns B. Sheet Header C. Sheet tab

_____________ is the most common religion in the Caribbean.

Find the slope and Y intercepts then write the equation of the line in slope-intercept form

Check the boxes listed with compounds. (More than one box)

Please help me with this homework

The Great Recession • In Chapter 29, read "The Great Recession" section and answer the following questions: 1. A boom in what industry set up the economy for an

When an atom _______ an electron, it charge is negative .

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

all that enterprises has a reputation for reliability and customer service, qualities that helped to build this highly respected name brand over the last 15 yea

In Pasteur's experiments, why didn't bacteria grow in the long necked flask?