carmellagutier carmellagutier
  • 01-09-2018
  • English
contestada

Which factors combine to form an authors purpose

Respuesta :

yuki430p7szcq yuki430p7szcq
  • 01-09-2018
The authors theme;what message is he trying to get across to the reader? The authors style;what elements of literature does he use to make the story understanding and interesting. Elements are: Imagery, Simile, Metaphor, Irony, Figurative language, Rome Sceme, Point of View etc..
Answer Link

Otras preguntas

What was religion like in Shang China?
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you write fifty-seven thousand,eighteen. In standard form
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s