mackd695mackd695
mackd695mackd695 mackd695mackd695
  • 03-05-2016
  • Biology
contestada

what is the relationship between gravity and water on earth's surface

Respuesta :

taskmasters
taskmasters taskmasters
  • 10-05-2016
the relationship between gravity and water on earth's surface can be explained through the idea about tidal forces. 
In general usage in celestial mechanics, the term ''tidal force'' can refer to a situation in which a body,  tidal water for example, is mainly under the gravitational influence of a second material, for instance, the Earth, but is also perturbed by the gravitational effects of a third body which is  the Moon for example.
Answer Link

Otras preguntas

A solution contains 2 1/2 cups of colored dye for every 2/5 quart of water. How many cups of colored dye are used for every 1 quart of water?
Nigel tried to solve an equation step by step. 1/2(2h-4)=20 ​ 2h−4=10 step1 2h=14 step2 h=7 step 3 What step did he FAIL on?​ ​
How did the development of the brain contribute to hominid evolution?
Are predators the only cause of population? Why? How can limited resources affect a population?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What's you'r zodiac sign? Mines a Leo ♌
What is the product of (3x+7) and (x-7) ?
find the missing measure. please help i’m so confused
1+4=.5 2+5=12 3+6=21 5+8=
What can you infer about how pharaohs were viewed and valued in Ancient Egyptian culture? Give two specific examples from the text to support your inference.