jordyndehaan2007 jordyndehaan2007

17-01-2020
Mathematics

contestada

Simplify the expression

4x+9y+3(x+y)

help needed

Respuesta :

ameliaxx ameliaxx

17-01-2020

The answer is 7x add 12y

Ver imagen ameliaxx

Answer Link

Otras preguntas

what is one means of reaching closure after the death of a loved one

What is the definition of civic-mindedness? A. paying attention to the needs of one’s community B. treating others with respect C. reading the newspaper on

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

Using the principles of VSEPR theory, you can predict the geometry around any atom in any molecule, no matter how complex. Enanthotoxin is a poisonous compound

Which was true about the Middle Colonies in the 1600s after the English had gained ownership? A. The Middle Colonies each had their own unique government and la

-15 What is the solution to x-9> Ο χ< 6 Ο Ox> 6 Ο χ< 24 Ο Ο Ο χ>-24

How many times does 1/3 go into 8/10?

Divide 630 by 5 using partial quotients

Listen Listen with ReadSpeaker Focus Users need to be able to make use of _____, such as rumors, unconfirmed reports, and stories, when solving problems.

what is the reaction between iron metal and copper (ii) which species is dispalced g