lbinolan lbinolan

01-05-2020
English

contestada

Which sentence contains an infinitive

Which sentence contains an infinitive class=

Respuesta :

devikapanicker1 devikapanicker1

01-05-2020

Answer:

I think the answer is B.

Explanation:

Verb: Ask

Infinitive: Offer

Answer Link

BlairMiller BlairMiller

07-12-2020

Answer: B.

Explanation: On Edge.

Answer Link

Otras preguntas

Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the interquartile range of the data? 17, 18, 18, 20, 23, 25, 27, 27, 34, 38, 40, 46, 46, 62, 67

The vessels that are responsible for carrying blood away from the heart are

Which hormone is essential to our ability to maintain our fluid levels?

According to Christian teaching, Jesus taught in ________________or short stories that used analogies to tell religious truth. Stories Analogies Metaphors Parab

What is the distance between points (-42, 63) and (-39, 67)?

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens

(60) Points HeLp asap 5 questions

Given the parent function of f(x) = x4, what change will occur when the function is changed to f, bracket one half x end bracket? A. Graph opens the same way an