Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Bears will eat just about anything: berries, fungi, salmon, insects, and much more. Bears are herbivores O carnivores omnivores

Draw the net force arrow on the picture to the left 14 points!

A race car is driving on the Bonneville Salt Flats in Utah. It starts out at at rest, 40.0 m east (+x) and 32.0 m north (+y) of a camping facility, which we wil

How many moles are there in 17.5g of mercury (I) nitride?

The unadjusted trial balance of Sandhill Exposure Inc. had these balances for the following select accounts: Supplies $3,500, Unearned Service Revenue $8,450, a

What two nutrients store energy ANSWER PLZ

10+(5v-7)=5v-3 Please answer this linear equation

REVIEW IT! 22. MAINIDEA The skydiver shown in Figure 13 falls at a constant speed in the spread- eagle position. Immediately after opening the parachute, is the

What is one way to make the introduction interesting to the reader?

Plz tell me the answer to this problem!!