keysharalzahra keysharalzahra

01-09-2020
Mathematics

contestada

A student can read 7 pages of a book in 10 minutes how many pages of the book can the student read in 30 minutes

Respuesta :

Guyhjutdc Guyhjutdc

01-09-2020

Answer:

210 pages

Step-by-step explanation:

7 pages = 10 minutes

A pages = 30 minutes

A = 210 pages

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A student is conducting an experiment to determine how far a ball will roll down a ramp based on the angle of incline. What are the independent and dependent

Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)

Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis

Need help ASAP !!!!!!!

Why is the answer for #6 A?

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions

The wealth and prosperity of mali and songhai were dependent on controlling the trade in

The name for people who stay in one place like civilization of china and kroea

How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?