nathaliabetances
nathaliabetances nathaliabetances
  • 01-02-2021
  • Mathematics
contestada

-2(3x + 2) > -6x - 4

Respuesta :

Unknown1360 Unknown1360
  • 01-02-2021

Answer: All real numbers are solutions.

Step-by-step explanation:

−2(3x+2)≥−6x−4

Step 1: Simplify both sides of the inequality.

−6x−4≥−6x−4

Step 2: Add 6x to both sides.

−6x−4+6x≥−6x−4+6x

−4≥−4

Step 3: Add 4 to both sides.

−4+4≥−4+4

0≥0

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A newborn baby weighs 2900 grams. How many pounds does this baby weigh? Also how many pounds, how many ounces
if f(x) = x²4+10, what is f(-7)?
Pokèmon Riddler:I am a dog, with fighting and steel, I got a move Aura Sphere, the strong I can feel. What Pokèmon Am I?
explain how you know the sum of 2,3 and -2 is positive without computing SHOW WORK PLZZZZZZ TYSM HAVE A GREATE DAY
how are the molecules of the plasma membrane arranged?
Write the name for the following set of numbers. 1, 3, 5, 7, 9, 11......... *a. Integersb. Indicesc. Odd Numbersd.Even Numbers​
What is the measure of m give your answer in the simplest form
Which of the following functions is graphed below?
Is this statement true or false? Any object from the past that was made by humans or by nature is called an artifact. true false