Seudónimo Seudónimo
  • 02-03-2021
  • Biology
contestada

Here ya go, I hope this helps zoey

Here ya go I hope this helps zoey class=

Respuesta :

Аноним Аноним
  • 02-03-2021

Answer: hey CC text me on Quora

Explanation:

Answer Link

Otras preguntas

what rule does static electricity follow
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
What is the additive inverse of -4a