clewis29 clewis29
  • 04-03-2021
  • Mathematics
contestada

What is this factored 3x^2 + 19x + 20

Respuesta :

bm66813 bm66813
  • 04-03-2021

Answer:(

(3x+4) x (x+5)

Step-by-step explanation:

Answer Link

Otras preguntas

Please answer theses division problems!! 9 divided by 3/7
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take