pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

A rectangular floor of area 360 m2 is going to be tiled. Each tile is rectangular, and has an area of 240 cm2. An exact number of tiles can be put into the spac
Dan invests £13000 into his bank account. He receives 2.3% per year simple interest. How much will Dan have after 4 years? Give your answer to the nearest penny
I need help with this word problem.
Which detail would best support this topic​ sentence? The residents of the retirement home appreciate it when younger people come by to do things with them. A.
Which fact about the author's background most likely influenced this game? On the poem from blossoms
What is constitution​
If f(x) = 2x + 1 and g(x) = x2 + 5, what is g(f(2))?
Which graph represents the piecewise-defined function? y = { 0 if x = 2 3 if x > 2 -4 if x ≤-3
True or false The moon is the only satellite that earth has
How to evaluate the creditworthiness of customers both individual consumers and business customers? ​