rashadthegreat2 rashadthegreat2
  • 02-06-2021
  • English
contestada

In the sentence below, the underlined portion is a phrase. Identify the type
of phrase.
He always behaves in a good manner.

Respuesta :

xAestheticLxlliesx
xAestheticLxlliesx xAestheticLxlliesx
  • 02-06-2021

In the sentence below, the underlined portion is a phrase. Identify the type

of phrase.

He always behaves in a good manner.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What are the asymptotes of the hyperbola with equation 9y^2 - 4x^2 = 36?
Vince chooses 3 side dishes from a total of 10 side dishes offered on the menu is how many different ways can he choose
Lisa creates a scatter plot of the number of minutes she runs on the treadmill and the calories she burns. About how many more calories does she burn for every
Marco is building a house. he bought lots of wood to make the frame of the house. he wants right angles for his corners. if he uses a piece of wood that is cut
What role did John Marshall serve in the new government? A. Head of Congress B. President C. Chief Justice D. Vice president Answer is C.
Find the length of the missing side of a right triangle if a=6 and c=11
Given the parent function of f(x) = x4, what change will occur when the function is changed to f, bracket one half x end bracket? A. Graph opens the same way an
Don’t know how to this, solve for x
Arrange the steps in the correct order for creating a digital image and saving it.