natsuuzumaki66 natsuuzumaki66
  • 03-06-2021
  • History
contestada

the Bolshevik Revolution brought many changes to Russia, but there was an aspect of continuity. what was it?​

Respuesta :

iaroccim2022
iaroccim2022 iaroccim2022
  • 03-06-2021

Answer:

The continuity of some of the worst aspects from Tsarism

Explanation:

The new Red regime instituted policies that allowed for the murder of political rivals and individuals seen as "dangerous" to Soviet ideology, as well as the torture and exile of said individuals.

Answer Link

Otras preguntas

What is a common noun of George Washington
Reproductive technologies allow culture to shape biology. These technologies are not new, but they are rapidly expanding. Identify the following technologies as
If an adjusting entry is made on the last day of the current accounting period by debiting Wages Expense and crediting Wages Payable for accrued wages earned bu
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
PLEASE HELP ME ASAP
Let F = sin ( 8 x + 5 z ) i − 8 y e x z k . F=sin⁡(8x+5z)i−8yexzk. Calculate div ( F ) div(F) and curl ( F ) . and curl(F). (Express numbers in exact form. Use
Highlight the ordered pair that is a the solution. Show your work to justify your answer.
Hi please help I keep getting the anwser wrong and really need to get at least 1/2 the two right or I’ll get a zero!!!pls
Examples of cultural myths
Who would be more likely to join the cross-country team (individual sport) instead of the volleyball team (team sport) and want to be captain of the team rather