adripalacios08
adripalacios08
03-01-2022
Mathematics
contestada
Evaluate -50 + 5/13p when p = -26
Respuesta :
chaconsophia135
chaconsophia135
15-01-2022
Answer: -60
Step-by-step explanation:
i just found it good luck
:)
Answer Link
VER TODAS LAS RESPUESTAS ( 65+ )
Otras preguntas
I keep getting the answer wrong for the value please help.
You have been saving nickels, dimes, and quarters in a jar for about a year. You decide to see how much money you've saved up. When you get everything counted i
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
Asia contains both the highest and lowest known points on earth. Mt. Everest is a little over 29,000 feet above sea level, and the shore of the Dead Sea is abou
doughnuts are sold in bags and cartons a bag holds 4 doughnuts and a carton holds 10 doughnuts tom buys b bags of doughnuts and c cartons of doughnuts he buys a
Prepare the adjusting journal entries for the following transactions. a. Supplies for office use were purchased during the year for $500, of which $100 remaine
Help as soon as possible PLS
(03.01 LC) In programming, what is an integer number? O A fraction O A number with a decimal O A round number O A number without a decimal
Which process uses the sun's energy to convert water on Earth's surface into water vapor? Condensation Evaporation Precipitation Transpiration
You drop your frozen rock from a green bridge. The frozen rock starts from rest (initial velocity = 0ms). The rock takes 4.3s to hit the water below. The accele
