bholaadhikari346 bholaadhikari346

01-06-2022
Biology

contestada

difference between yeast and mushroom

Respuesta :

kamiyagreenfield kamiyagreenfield

01-06-2022

Answer:

Fungi are mostly multicellular, consisting of fungal hyphae. Both yeast and fungi are saprotrophs, which secrete enzymes on decaying organic matter. The main difference between yeast and fungi is their structure.

Explanation:

Answer Link

Otras preguntas

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim

Yahaira is ready to reach the next level in her fitness. She is in great shape, but she still lacks the power needed to lift heavy objects. Which of the followi

what was a power given by the articles of confederation

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The federal government's insurance program for the elderly and disabled is called:

TRUE OR FALSE HELP QUICK

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

Help me please im about to give up

(75) pointsPlease help me on these questions ASAP!!!

Why does an insertion mutation usually cause more defects during protein synthesis than a point mutation? a. insertion mutations only occur during transcription