Seudónimo Seudónimo
  • 02-02-2017
  • Chemistry
contestada

Please help l need to correct it

Please help l need to correct it class=

Respuesta :

xphenomx
xphenomx xphenomx
  • 02-02-2017
You cannot create or destroy mass so the answer is A. Mass is conserved through any change of state.
Answer Link
littledebbie littledebbie
  • 02-02-2017
The answer to the question is a
Answer Link

Otras preguntas

What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Compliant is to stubborn as excited is to
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
accurate estimation 719-348
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?