michaelcamp831 michaelcamp831
  • 01-03-2017
  • Biology
contestada

Ocean currents move warm and cold water around the Earth, affecting Earth's __________.

Respuesta :

Kh10595
Kh10595 Kh10595
  • 01-03-2017
Climate and weather, since the ocean currents circulate warm and cold water around the earth. Kind of like the butterfly affect, one thing happens over there another thing happens over here. I hope that you find this helpful!
Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
what is the lcd of 10/11,29/44
what are the 2 major types of cofactors?
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
where are the three parts of an atom located
a antonym for biosphere