Seudónimo Seudónimo
  • 01-03-2015
  • Mathematics
contestada

hilary can read 560 words in 7 minutes how many words can hilary read in 1 minute

Respuesta :

naǫ
naǫ naǫ
  • 01-03-2015
[tex]\frac{560 \ words}{7 \ min}=\frac{560}{7} \ \frac{words}{min} = 80 \ \frac{words}{min}[/tex]

Hilary can read 80 words in 1 minute.
Answer Link
nasalover64 nasalover64
  • 01-03-2015
80. If Hilary can Read 560 in 7 minutes and you want to find out One minute you can set up a proportion of 560/7 * X/1 and solve the proportion by multiplying 560 by 1 then dividing by 7.
Answer Link

Otras preguntas

How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
What was religion like in Shang China?
How do you write fifty-seven thousand,eighteen. In standard form
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Companies raise funds to expand their business by
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
What does hemostasis mean?