1NeedHelp1 1NeedHelp1
  • 04-04-2017
  • Mathematics
contestada

Write an equivalent expression for n X a using only addition

Respuesta :

Аноним Аноним
  • 04-04-2017
it depends on what the variables are. If they tell you the variables, then it will be n + ( if a is 1, put 1 a. If a is 2 put 2 a's).

If they don't tell you them then i am not sure
Answer Link

Otras preguntas

solve the simultaneous equation 4x+7y=1 3x+10y=15
Help pl0x, Algebra 1
who fought against each other in the crusades?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what might be learned from an incorrect hypothesis
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October