aheadrick3169 aheadrick3169
  • 04-07-2017
  • Social Studies
contestada

a bicameral, or to two-house, congress was a feature of which plan for the federal government presented at the Constitutional Convention?

Respuesta :

bereniceluna76 bereniceluna76
  • 13-07-2017
virginia plan is the answer


Answer Link
joanrios14 joanrios14
  • 07-05-2020

Answer:

The Virginia plan

Explanation:

Ape x

Answer Link

Otras preguntas

the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
How well did feudalism establish order in the Middle ages?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Companies raise funds to expand their business by
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Susan ........ (Run) to school because she was late.
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile