theylovearii24
theylovearii24 theylovearii24
  • 03-01-2018
  • Mathematics
contestada

help me plot please.

help me plot please class=

Respuesta :

herdman5053
herdman5053 herdman5053
  • 03-01-2018
one at 100,18 one at 200,14 one at 150,15 one at 125,20 and one at 225,12
Answer Link
niveprabhu02
niveprabhu02 niveprabhu02
  • 03-01-2018
The graph below given with answers
Ver imagen niveprabhu02
Answer Link

Otras preguntas

Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
How has water influenced the development of civilization in Africa
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
What was George Washington's nickname?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a