FizzyWhizz FizzyWhizz
  • 03-03-2018
  • Biology
contestada

What are the three types of mutations

Respuesta :

Janay1012
Janay1012 Janay1012
  • 03-03-2018
Deletions are mutations in which a section of DNA is lost, or deleted. Since protein-coding DNA is divided into codons three bases long, insertions and deletions can alter a gene so that its message is no longer correctly parsed. These changes are called frameshifts.
Answer Link

Otras preguntas

Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei
If you take in fewer calories than you need you have a what energy balance
how was the 20th maine regiment so instrumental in winning the Battle of Gettysburg?
How is the creation of public policy in Russia different from that in the United States?
stars and planets are made from gases in a
9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
why is the inner mitochondrial membrane folded
As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D
crystal lattice definition