msoria12345 msoria12345

04-03-2018
History

contestada

What roles did colonies play in the global economy

Respuesta :

Cutiepatutie Cutiepatutie

04-03-2018

In British Mercantilism...goods they had went across the world and back...if you need to explain more I will.

Hope this helps!

Answer Link

Otras preguntas

what is 3/5 of 21? plz answer the question

One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which two states were admitted to the united states as part of the missouri compromise?

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?

Which component of a phospholipid is found in the interior of a lipid bilayer?

Which of the following can not make you more fatigued when driving? A. Depressants B. Stimulants C. Barbiturates D. None of the above

Find the measure of an exterior angle of each regular polygon: 100-gon.

N general, emerging adulthood is a time during which a person functions physically and psychologically at an optimal level.