Pebbles2008 Pebbles2008

03-01-2021
Mathematics

contestada

The parallelograms below are similar.

Find the length of side AB and the measure of angle E.

Side AB =

Angle E =

The parallelograms below are similar Find the length of side AB and the measure of angle E Side AB Angle E class=

Respuesta :

laryajos laryajos

03-01-2021

Answer:

The length of sideAB=4

The measure of angle E=60

Answer Link

vinceb665 vinceb665

03-01-2021

The answer is e=40 hope it help

Answer Link

Otras preguntas

pleeeeeas helpp mehh!!!!! ahhhKansas-Nebraska Act *A. created the Kansas and Nebraska territories and abolished the Missouri Compromiseby allowing settlers to d

Find the unknown length. Round to the nearest tenth if necessary.

Anyone Can Help Me Pliz? Its Due Today I Would Appreciate It

Factor Polynomial 3y^2+y-14

Where do we find large Chilean communities today?

A class goes to a science museum. There is an exhibit which has a giant sphere that shows different weather patterns. The surface area of the sphere is 24,316.1

help with this q pleaseee

2. What are the four most important characteristics to consider when communicating with an audience? age, gender, religion, and height cultural factors, age, ge

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

I will give brainliest! Briefly discuss at least three positives or negatives of globalization in the world today. In addition, how has globalization reduced th